Biology 1 - The Life Sciences » 2019 » Module 4 Exam

Need help with your exam preparation?

Question #1
RNA is composed of building blocks called
A.   phospholipids
B.   disaccharides
C.   amino acids
D.   nucleotides
E.   monosaccharides
Question #2
In Transcription, DNA is copied to produce
A.   RNA polymerase
B.   transfer RNA
C.   a ribosome
D.   messenger RNA
Question #3
In Translation, what brings in new amino acids?
A.   the amino acids
B.   the transfer RNA
C.   the ribosome
D.   RNA polymerase
Question #4
RNA differs from DNA in many ways, including
A.   DNA is double stranded and RNA is single stranded. 
B.   RNA can catalyze some chemical reactions and DNA cannot.
C.   DNA contains deoxyribose and RNA contains ribose
D.   DNA contains thymine and RNA contains uracil instead of thymine
E.   All of the above are correct
Question #5
 If the DNA template strand has the following sequence, what would be the nucleotide sequence of the complementary RNA molecule produced in transcription? Template strand: GACCTTA
A.   CUGGAAU
B.    TCAGAA
C.    UCAGAA
D.    AGTCTT
Question #6
rRNA carries the instructions for translation.
A.   TRUE
B.   FALSE
Question #7
Proteins are made up of ______ different kinds of amino acid.
A.   20
B.   46
C.   50
D.   4
Question #8
In eukaryotic cells, sequences of mRNA that are NOT removed before translation are called  
A.   terminators
B.   introns
C.   anticodons
D.   exons
Question #9
What is the anticodon for GUU?
A.   TAG
B.   UAG
C.   CAA
D.   None of the above
Question #10
Your entire genetic code is analogous to ________________.
A.   a recipe
B.   an electric motor
C.   a cook
D.   a cookbook
Question #11
The step of translation in which the first amino acids joins the ribosome and mRNA is  
A.   elongation
B.   initiation
C.   mitosis
D.   termination
Question #12
A group of genes, a promoter, and an operator that control transcription are called a(n
A.   ribosome.
B.   translational unit.
C.   envelope. 
D.   operon.
E.   chromosome. 
Question #13
What amino acid code does ACU code for?
A.   both Serine and Proline
B.   Serine
C.   Arginine
D.   Proline
E.   Threonine
F.   Leucine
Question #14
In a "nonsense" mutation  
A.   the mutation is not in DNA.
B.   the codon that mutates does not cause a change in the amino acid specified. 
C.   the codon that mutates causes a change in the amino acid specified. 
D.   the codon that mutates causes a stop codon to occur instead of the placement of an amino acid. 
Question #15
How many codons are in the mRNA sequence GGAAUGAAACAGGAACCCAAA?  
A.   4
B.   7
C.   18
D.   10
Question #16
All mutations involve some kind of change in the genetic code.
A.   TRUE
B.   FALSE
Question #17
All mutations are harmful
A.   TRUE
B.   FALSE
Question #18
Many viruses are inhibited by antibiotics
A.   TRUE
B.   FALSE
Question #19
DNA is packaged in units called
A.   centromeres
B.   centrosomes
C.   chromosomes
D.   histones
Question #20
Bacteria go through a form of cell division called _____________.
A.   binary fusion
B.   Cytokinesis
C.   binary fission
D.   None of the above
Question #21
The majority of a cell's life cycle is spent in
A.   Cytokinesis
B.   G2 phase
C.   Mitosis
D.   Interphase
Question #22
In mitosis of animal cells, cytokinesis involves the
A.   the splitting of nucleus
B.   the formation of a cell plate
C.   formation of the membranes
D.   the formation of a cleavage furrow
Question #23
Which phase of the cell cycle directly precedes mitosis?
A.   S phase
B.   G1 phase
C.   Cytokinesis
D.   G2 phase
Question #24
When a cell first enters into cell division, the DNA in its nucleus
A.   is copied
B.   unravels to form chromatin
C.   completely disintegrates
D.   condenses to form thick, ribbonlike chromosomes
Question #25
When, during mitosis, do we first see the functioning centrosomes?
A.   Anaphase
B.   Prophase
C.   Telophase
D.   Metaphase
Question #26
Which phase of mitosis occurs second in the change of events?
A.   Telophase
B.   Anaphase
C.   Prophase
D.   Metaphase
Question #27
Which phase of mitosis involves the forming of the nuclear membrane?
A.   Anaphase
B.   Metaphase
C.   Telophase
D.   Prophase
Question #28
In some fungi and slime molds, mitosis may occur without cytokinesis. What would you expect to find in these species?
A.   DNA that never condenses into visible chromosomes
B.   cells that contain multiple nuclei
C.   cells that don't contain nuclei
D.   nuclei that never enter interphase
Question #29
During cytokinesis of a plant cell, the cell divides by forming a cleavage furrow.
A.   FALSE
B.   TRUE
Question #30
The chemotherapy drug taxol inhibits microtubule function. A cell treated with taxol would become stuck in which phase?  
A.   telophase
B.   prophase
C.   telophase
D.   anaphase
Question #31
Cancer is believed to be associated with a failure of the cell cycle.
A.   TRUE
B.   FALSE
Question #32
What is the main function of DNA?,,
A.   to speed up cell reactions
B.   to encode proteins
C.   to produce ATP
D.   to provide structural support to the cell

Need help with your exam preparation?