Biology 1 - The Life Sciences » 2019 » Module 4 Exam

Need help with your exam preparation?

Question #1
RNA is composed of building blocks called
A.   nucleotides
B.   phospholipids
C.   monosaccharides
D.   amino acids
E.   disaccharides
Question #2
In Transcription, DNA is copied to produce
A.   messenger RNA
B.   RNA polymerase
C.   a ribosome
D.   transfer RNA
Question #3
In Translation, what brings in new amino acids?
A.   the transfer RNA
B.   RNA polymerase
C.   the ribosome
D.   the amino acids
Question #4
RNA differs from DNA in many ways, including
A.   DNA contains thymine and RNA contains uracil instead of thymine
B.   DNA contains deoxyribose and RNA contains ribose
C.   DNA is double stranded and RNA is single stranded. 
D.   RNA can catalyze some chemical reactions and DNA cannot.
E.   All of the above are correct
Question #5
 If the DNA template strand has the following sequence, what would be the nucleotide sequence of the complementary RNA molecule produced in transcription? Template strand: GACCTTA
A.   CUGGAAU
B.    AGTCTT
C.    TCAGAA
D.    UCAGAA
Question #6
rRNA carries the instructions for translation.
A.   TRUE
B.   FALSE
Question #7
Proteins are made up of ______ different kinds of amino acid.
A.   4
B.   50
C.   46
D.   20
Question #8
In eukaryotic cells, sequences of mRNA that are NOT removed before translation are called  
A.   terminators
B.   introns
C.   exons
D.   anticodons
Question #9
What is the anticodon for GUU?
A.   TAG
B.   UAG
C.   CAA
D.   None of the above
Question #10
Your entire genetic code is analogous to ________________.
A.   a cook
B.   a cookbook
C.   an electric motor
D.   a recipe
Question #11
The step of translation in which the first amino acids joins the ribosome and mRNA is  
A.   initiation
B.   mitosis
C.   termination
D.   elongation
Question #12
A group of genes, a promoter, and an operator that control transcription are called a(n
A.   ribosome.
B.   translational unit.
C.   envelope. 
D.   chromosome. 
E.   operon.
Question #13
What amino acid code does ACU code for?
A.   Leucine
B.   Serine
C.   Threonine
D.   both Serine and Proline
E.   Proline
F.   Arginine
Question #14
In a "nonsense" mutation  
A.   the codon that mutates causes a change in the amino acid specified. 
B.   the codon that mutates does not cause a change in the amino acid specified. 
C.   the codon that mutates causes a stop codon to occur instead of the placement of an amino acid. 
D.   the mutation is not in DNA.
Question #15
How many codons are in the mRNA sequence GGAAUGAAACAGGAACCCAAA?  
A.   18
B.   7
C.   10
D.   4
Question #16
All mutations involve some kind of change in the genetic code.
A.   TRUE
B.   FALSE
Question #17
All mutations are harmful
A.   FALSE
B.   TRUE
Question #18
Many viruses are inhibited by antibiotics
A.   TRUE
B.   FALSE
Question #19
DNA is packaged in units called
A.   chromosomes
B.   centrosomes
C.   centromeres
D.   histones
Question #20
Bacteria go through a form of cell division called _____________.
A.   binary fission
B.   binary fusion
C.   Cytokinesis
D.   None of the above
Question #21
The majority of a cell's life cycle is spent in
A.   Interphase
B.   G2 phase
C.   Mitosis
D.   Cytokinesis
Question #22
In mitosis of animal cells, cytokinesis involves the
A.   formation of the membranes
B.   the splitting of nucleus
C.   the formation of a cell plate
D.   the formation of a cleavage furrow
Question #23
Which phase of the cell cycle directly precedes mitosis?
A.   S phase
B.   Cytokinesis
C.   G2 phase
D.   G1 phase
Question #24
When a cell first enters into cell division, the DNA in its nucleus
A.   condenses to form thick, ribbonlike chromosomes
B.   unravels to form chromatin
C.   is copied
D.   completely disintegrates
Question #25
When, during mitosis, do we first see the functioning centrosomes?
A.   Telophase
B.   Anaphase
C.   Prophase
D.   Metaphase
Question #26
Which phase of mitosis occurs second in the change of events?
A.   Prophase
B.   Metaphase
C.   Telophase
D.   Anaphase
Question #27
Which phase of mitosis involves the forming of the nuclear membrane?
A.   Metaphase
B.   Telophase
C.   Anaphase
D.   Prophase
Question #28
In some fungi and slime molds, mitosis may occur without cytokinesis. What would you expect to find in these species?
A.   nuclei that never enter interphase
B.   cells that don't contain nuclei
C.   DNA that never condenses into visible chromosomes
D.   cells that contain multiple nuclei
Question #29
During cytokinesis of a plant cell, the cell divides by forming a cleavage furrow.
A.   TRUE
B.   FALSE
Question #30
The chemotherapy drug taxol inhibits microtubule function. A cell treated with taxol would become stuck in which phase?  
A.   prophase
B.   anaphase
C.   telophase
D.   telophase
Question #31
Cancer is believed to be associated with a failure of the cell cycle.
A.   TRUE
B.   FALSE
Question #32
What is the main function of DNA?,,
A.   to speed up cell reactions
B.   to encode proteins
C.   to provide structural support to the cell
D.   to produce ATP

Need help with your exam preparation?