Biology 1 - The Life Sciences » 2019 » Module 4 Exam

Need help with your exam preparation?

Question #1
RNA is composed of building blocks called
A.   disaccharides
B.   nucleotides
C.   phospholipids
D.   amino acids
E.   monosaccharides
Question #2
In Transcription, DNA is copied to produce
A.   a ribosome
B.   transfer RNA
C.   messenger RNA
D.   RNA polymerase
Question #3
In Translation, what brings in new amino acids?
A.   the amino acids
B.   RNA polymerase
C.   the ribosome
D.   the transfer RNA
Question #4
RNA differs from DNA in many ways, including
A.   DNA is double stranded and RNA is single stranded. 
B.   RNA can catalyze some chemical reactions and DNA cannot.
C.   DNA contains thymine and RNA contains uracil instead of thymine
D.   DNA contains deoxyribose and RNA contains ribose
E.   All of the above are correct
Question #5
 If the DNA template strand has the following sequence, what would be the nucleotide sequence of the complementary RNA molecule produced in transcription? Template strand: GACCTTA
A.   CUGGAAU
B.    AGTCTT
C.    TCAGAA
D.    UCAGAA
Question #6
rRNA carries the instructions for translation.
A.   FALSE
B.   TRUE
Question #7
Proteins are made up of ______ different kinds of amino acid.
A.   50
B.   46
C.   20
D.   4
Question #8
In eukaryotic cells, sequences of mRNA that are NOT removed before translation are called  
A.   terminators
B.   exons
C.   anticodons
D.   introns
Question #9
What is the anticodon for GUU?
A.   TAG
B.   UAG
C.   CAA
D.   None of the above
Question #10
Your entire genetic code is analogous to ________________.
A.   a cook
B.   an electric motor
C.   a recipe
D.   a cookbook
Question #11
The step of translation in which the first amino acids joins the ribosome and mRNA is  
A.   termination
B.   mitosis
C.   elongation
D.   initiation
Question #12
A group of genes, a promoter, and an operator that control transcription are called a(n
A.   ribosome.
B.   translational unit.
C.   operon.
D.   chromosome. 
E.   envelope. 
Question #13
What amino acid code does ACU code for?
A.   Serine
B.   Arginine
C.   Threonine
D.   Proline
E.   Leucine
F.   both Serine and Proline
Question #14
In a "nonsense" mutation  
A.   the codon that mutates causes a stop codon to occur instead of the placement of an amino acid. 
B.   the mutation is not in DNA.
C.   the codon that mutates causes a change in the amino acid specified. 
D.   the codon that mutates does not cause a change in the amino acid specified. 
Question #15
How many codons are in the mRNA sequence GGAAUGAAACAGGAACCCAAA?  
A.   7
B.   4
C.   10
D.   18
Question #16
All mutations involve some kind of change in the genetic code.
A.   FALSE
B.   TRUE
Question #17
All mutations are harmful
A.   FALSE
B.   TRUE
Question #18
Many viruses are inhibited by antibiotics
A.   TRUE
B.   FALSE
Question #19
DNA is packaged in units called
A.   histones
B.   centrosomes
C.   chromosomes
D.   centromeres
Question #20
Bacteria go through a form of cell division called _____________.
A.   binary fission
B.   binary fusion
C.   Cytokinesis
D.   None of the above
Question #21
The majority of a cell's life cycle is spent in
A.   Cytokinesis
B.   Interphase
C.   Mitosis
D.   G2 phase
Question #22
In mitosis of animal cells, cytokinesis involves the
A.   the formation of a cell plate
B.   the splitting of nucleus
C.   the formation of a cleavage furrow
D.   formation of the membranes
Question #23
Which phase of the cell cycle directly precedes mitosis?
A.   S phase
B.   Cytokinesis
C.   G2 phase
D.   G1 phase
Question #24
When a cell first enters into cell division, the DNA in its nucleus
A.   is copied
B.   condenses to form thick, ribbonlike chromosomes
C.   completely disintegrates
D.   unravels to form chromatin
Question #25
When, during mitosis, do we first see the functioning centrosomes?
A.   Prophase
B.   Anaphase
C.   Metaphase
D.   Telophase
Question #26
Which phase of mitosis occurs second in the change of events?
A.   Metaphase
B.   Anaphase
C.   Prophase
D.   Telophase
Question #27
Which phase of mitosis involves the forming of the nuclear membrane?
A.   Prophase
B.   Telophase
C.   Metaphase
D.   Anaphase
Question #28
In some fungi and slime molds, mitosis may occur without cytokinesis. What would you expect to find in these species?
A.   cells that contain multiple nuclei
B.   cells that don't contain nuclei
C.   DNA that never condenses into visible chromosomes
D.   nuclei that never enter interphase
Question #29
During cytokinesis of a plant cell, the cell divides by forming a cleavage furrow.
A.   FALSE
B.   TRUE
Question #30
The chemotherapy drug taxol inhibits microtubule function. A cell treated with taxol would become stuck in which phase?  
A.   prophase
B.   anaphase
C.   telophase
D.   telophase
Question #31
Cancer is believed to be associated with a failure of the cell cycle.
A.   TRUE
B.   FALSE
Question #32
What is the main function of DNA?,,
A.   to speed up cell reactions
B.   to produce ATP
C.   to provide structural support to the cell
D.   to encode proteins

Need help with your exam preparation?