Biology 003 - Introduction to Biology » Fall 2022 » Test 2 Chp 6-10

Need help with your exam preparation?

Question #1
Which of the following are products of the light reactions that are then used in the Calvin Cycle?
A.   NAD+ and ADP
B.   NADPH and ATP
C.   Glucose and Oxygen
D.   ATP and Glucose
Question #2
Fermentation reactions generaly happen under conditions of:
A.   extreme drought
B.   extremely high temperautres
C.   low glucose levels
D.   low oxygen concentrations
E.   high oxygen concentrations
Question #3
The light reactions of photosynthesis occurs in the
A.   Polygenic
B.   Thylakoids
C.   Pleiotropy
D.   Cytokinesis
Question #4
Skin color and height are examples are
A.   Pleiotropy
B.   Codominance
C.   Mendelian genetics
D.   Polygenic
Question #5
If you bred a white chicken and a black chicken together and they were Codominant traits, the offspring would be what color?
A.   Black
B.   Grey
C.   Black and White speckled
D.   White
Question #6
Which of the following is NOT true about Mitosis?
A.   It happens in somatic cells
B.   It produces 2 daughter cells
C.   It seperates sister chromatids
D.   It consists of Interphase, metaphase, anaphase and telophase
Question #7
Osmosis:
A.   is the passive transport of solutes across a membrane
B.   is the passive transposrt of water across a membrane
C.   Can transport molecules from low concentartion to high concentration
D.   uses ATP as an energy source
Question #8
What kind of mutation is this? old- ATTCGCATACG new -ATTCGGATACG
A.   Substitution
B.   Insertion
C.   Deletion
D.   No mutation
Question #9
Which of the following crosses would produce an offspring that is homozygous recessive?
A.   YY x yy
B.   yy x yy
C.   YY x Yy
D.   YY x YY
Question #10
Sex linked traits are shown more often when on in the _____________.
A.   Male's Y chromosome
B.   Male's X chromosome
C.   Mother's X chromosomes
Question #11
Which of the following lists the reactions of cellular respiration in the correct order?
A.   electron transport chain; glycolysis; Krebs (citric acid) cycle; acetyl-coA production
B.   acetyl-coA production; Krebs (citric acid) cycle; electron transport chain; glycolysis
C.   glycolysis; acetyl-coA production; electron transport chain; Krebs (citric acid) cycle
D.   Krebs (citric acid) cycle; glycolysis; acetyl-coA production; electron transport chain
E.   glycolysis; acetyl-coA production; Krebs (citric acid) cycle; electron transport chain
Question #12
Fermentation, glycolysis and the Krebs cycle produce 2 ATP each.
A.   True
B.   False
Question #13
Cytokinesis is considered a part of Meiosis but not Mitosis.
A.   False
B.   True
Question #14
Lactic acid is a byproduct of fermentation that occurs in yeast to make ethyl alcohol.
A.   True
B.   False
Question #15
ABO blood types are considered incompletely dominant.
A.   True
B.   False
Question #16
Enzymes act as catalysts by raising the activation energy needed for a chemical reaction to proceed.
A.   True
B.   False
Question #17
Enzyme inhibitors can prevent a reaction from occurring by binding to the enzyme active site.
A.   False
B.   True
Question #18
The greatest amount of ATP is produced during the glycolysis step of cellular respiration.
A.   False
B.   True
Question #19
Match the term with the example. Black chicken and a white chicken have a gray chicken offspring.
A.   Polygenic
B.   Incompletely dominant
C.   Codominant
D.   Pure dominance
Question #20
Match the term with the example. A red flower and a white flower are bred to have a white and red speckled offpspring
A.   Incompletely dominant
B.   Codominant
C.   Polygenic
D.   Pleiotopy
Question #21
Match the term with the example. A freckled woman and a non freckled man have a freckled baby
A.   Codominant
B.   Polygenic
C.   Incompletely dominant
D.   Pure dominance
Question #22
Match the term with the example. Sickle cell and malaria resistance both show up
A.   Pure dominance
B.   Codominant
C.   Polygenic
D.   Pleiotopy
Question #23
Transcription occurs in the cytoplasm of the cell.
A.   True
B.   False
Question #24
Which is NOT apart of RNA processing.
A.   RNA polymerase opens up DNA
B.   Interons are removed from the RNA
C.   A poly-A tail is added to the mRNA
D.   A cap is added to the start of the mRNA
E.   Exons are spliced togther to make mRNA
Question #25
What is the complimentary mRNA for this piece of DNA? 3' ATCGTACTGCATATGAAC 5'             
A.   5' GCGTACGCATTCATGCCGACTCAA 3'
B.   5' UAGCAAGACGUAUACAUG 3'
C.   5' UAGCAUGACGUAUACUUG 3'
D.   3' UAGCAUGAAGUAUACUUG 5'

Need help with your exam preparation?