Biology 003 - Introduction to Biology » Fall 2022 » Test 2 Chp 6-10

Need help with your exam preparation?

Question #1
Which of the following are products of the light reactions that are then used in the Calvin Cycle?
A.   NAD+ and ADP
B.   Glucose and Oxygen
C.   ATP and Glucose
D.   NADPH and ATP
Question #2
Fermentation reactions generaly happen under conditions of:
A.   low glucose levels
B.   extremely high temperautres
C.   high oxygen concentrations
D.   extreme drought
E.   low oxygen concentrations
Question #3
The light reactions of photosynthesis occurs in the
A.   Thylakoids
B.   Cytokinesis
C.   Polygenic
D.   Pleiotropy
Question #4
Skin color and height are examples are
A.   Mendelian genetics
B.   Polygenic
C.   Codominance
D.   Pleiotropy
Question #5
If you bred a white chicken and a black chicken together and they were Codominant traits, the offspring would be what color?
A.   Black and White speckled
B.   White
C.   Black
D.   Grey
Question #6
Which of the following is NOT true about Mitosis?
A.   It produces 2 daughter cells
B.   It consists of Interphase, metaphase, anaphase and telophase
C.   It seperates sister chromatids
D.   It happens in somatic cells
Question #7
Osmosis:
A.   uses ATP as an energy source
B.   is the passive transport of solutes across a membrane
C.   Can transport molecules from low concentartion to high concentration
D.   is the passive transposrt of water across a membrane
Question #8
What kind of mutation is this? old- ATTCGCATACG new -ATTCGGATACG
A.   Insertion
B.   Deletion
C.   Substitution
D.   No mutation
Question #9
Which of the following crosses would produce an offspring that is homozygous recessive?
A.   YY x yy
B.   YY x YY
C.   yy x yy
D.   YY x Yy
Question #10
Sex linked traits are shown more often when on in the _____________.
A.   Male's X chromosome
B.   Male's Y chromosome
C.   Mother's X chromosomes
Question #11
Which of the following lists the reactions of cellular respiration in the correct order?
A.   acetyl-coA production; Krebs (citric acid) cycle; electron transport chain; glycolysis
B.   Krebs (citric acid) cycle; glycolysis; acetyl-coA production; electron transport chain
C.   glycolysis; acetyl-coA production; electron transport chain; Krebs (citric acid) cycle
D.   glycolysis; acetyl-coA production; Krebs (citric acid) cycle; electron transport chain
E.   electron transport chain; glycolysis; Krebs (citric acid) cycle; acetyl-coA production
Question #12
Fermentation, glycolysis and the Krebs cycle produce 2 ATP each.
A.   True
B.   False
Question #13
Cytokinesis is considered a part of Meiosis but not Mitosis.
A.   True
B.   False
Question #14
Lactic acid is a byproduct of fermentation that occurs in yeast to make ethyl alcohol.
A.   True
B.   False
Question #15
ABO blood types are considered incompletely dominant.
A.   False
B.   True
Question #16
Enzymes act as catalysts by raising the activation energy needed for a chemical reaction to proceed.
A.   False
B.   True
Question #17
Enzyme inhibitors can prevent a reaction from occurring by binding to the enzyme active site.
A.   False
B.   True
Question #18
The greatest amount of ATP is produced during the glycolysis step of cellular respiration.
A.   True
B.   False
Question #19
Match the term with the example. Black chicken and a white chicken have a gray chicken offspring.
A.   Incompletely dominant
B.   Pure dominance
C.   Codominant
D.   Polygenic
Question #20
Match the term with the example. A red flower and a white flower are bred to have a white and red speckled offpspring
A.   Pleiotopy
B.   Codominant
C.   Incompletely dominant
D.   Polygenic
Question #21
Match the term with the example. A freckled woman and a non freckled man have a freckled baby
A.   Codominant
B.   Polygenic
C.   Pure dominance
D.   Incompletely dominant
Question #22
Match the term with the example. Sickle cell and malaria resistance both show up
A.   Codominant
B.   Polygenic
C.   Pure dominance
D.   Pleiotopy
Question #23
Transcription occurs in the cytoplasm of the cell.
A.   True
B.   False
Question #24
Which is NOT apart of RNA processing.
A.   Interons are removed from the RNA
B.   Exons are spliced togther to make mRNA
C.   RNA polymerase opens up DNA
D.   A cap is added to the start of the mRNA
E.   A poly-A tail is added to the mRNA
Question #25
What is the complimentary mRNA for this piece of DNA? 3' ATCGTACTGCATATGAAC 5'             
A.   3' UAGCAUGAAGUAUACUUG 5'
B.   5' UAGCAAGACGUAUACAUG 3'
C.   5' UAGCAUGACGUAUACUUG 3'
D.   5' GCGTACGCATTCATGCCGACTCAA 3'

Need help with your exam preparation?